Information

How is DNA testing used to differentiate between different species?

How is DNA testing used to differentiate between different species?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

How is DNA testing used to determine that specimens belong to different species, rather than being subspecies, or members of the same species? Usually the definition of species is about the ability to produce fertile offspring under natural conditions. How are markers chosen that indicate individuals are different species?

Or does this process occur the other way around? Are species identified as being different, then DNA used to identify which members are which?


Statistics of divergence

You can compute various statistics of group divergence. Typically you could consider the pairwise number of differences between any pair of individuals. For example the following two sequences

ATATATCCTGTGTCAAAATATCTTGTGTCA

has 2 differences.

Obvious or obscure grouping

Often, individuals really group together quite naturally (if you perform a principle component analysis you will see clearly defined groups) but sometimes the groups are quite blurry.

The definition of species is arbitrary

Whether the grouping is blurry or not, it is often quite arbitrary how much two groups need to be different in order to classify them in different populations, different subspecies or different species, different genera, etc…

The problem here is more a problem of definition than a technical problem. You should have a look at this post to understand the issue behind the definition of species.


My attempt at a high school level explanation

Explain what a phylogenetic tree is

First draw a phylogenetic tree. Explain what they mean:

  • A node is an common ancestor
  • A leaf is a extant species (if the leaf gets to the top of the tree)
  • All species are related but some are more related than others…
  • Introduce the concept of sister clade
  • Explain that every species in a sister clade is equally related to the all the species in the other sister clade by highlighting their common ancestor.
  • Explain that no extant species is the ancestor of another species as the ancestors are the nodes.

You can get a short introduction to phylogenetic trees here on Biology.SE or here on Understanding Evolution.

Methods to reconstruct a phylogenetic tree

Let them wonder how we could get to know what the true phylogenetic tree is.

Suggest using phenotypic data and make them realize and if you put all the yellow flowers together, or the flying organisms (insects, birds, bats, squirrels) it won't work very well. So phenotypic data can sometimes be misleading. So explain that we can use genetic data by counting the number of pairwise differences. Let's consider the three different sequences

species A:ATCTCTGspecies B:ATCTCTTspecies C:AGGCATT

It sounds like the first two sequences are more closely related than any of them are to the third sequence. You can draw the tree for these three species.

Molecular clock (optional)

Knowing the rate at which mutations occur, one can date since when two lineages diverged based on genetic data. You will probably have to learn a bit more about molecular clock for yourself. You may ask a for high school explanation in another post.

Within population diversity (optional)

Recognizing the existence of genetic diversity within population is key to all evolutionary processes so it is good to let them understand the existence of such diversity early on.

Of course there is genetic diversity within a species that renders everything a little bit more complicated. For example, some of you have blue eyes while others have brown eyes (assuming there is variation for eye color among your students), this is due to the fact that the DNA sequence within each of you is a little different. Not as different as it is between humans and chimpanzee but a little bit different.

Genetic data to group populations into species

Then, you can say that genetic data can allow us to tell groups apart. You can show a PCA type of plot (without really explaining what a PCA really is) with colors. Each color correspond to a population (insiste on term population and not species). Something like

and then argue informally that light-yellow, green and red populations are probably different species while all the other populations seem to belong to the same species.

Problem with the species definition

If you really want to bring the question of the how to use genetic data to tell species apart, then you will first have to destroy their concept of species! For that, you should first have a look at this post. You will have to

  • Introduce the biological concept of species
  • Explain why this concept does not work for asexual species (hopefully they know that many species are asexual).
  • Give an example of another issue such as the classical (yet rarely observed) example of ring species (see here on Biology.SE or here on wikipedia)

Then, get back to the PCA and ask, how different two populations must be for them to be called different species? And make them realize that this is rather arbitrary. We can tell they are different lineages but it is up to everyone to decide what we want to call a species. However, very often vague intuition about how different a species should be is good enough.


Difference Between RAPD and RFLP

Genetic markers are used in Molecular Biology to identify genetic variations between individuals and species. Random Amplified Polymorphic DNA (RAPD) and Restriction Fragment Length Polymorphism (RFLP) are two important molecular markers routinely used in laboratories. RAPD is performed with short and arbitrary oligonucleotide primers, and it is based on the random amplification of the multiple locations throughout the template DNA of the organism. RFLP is performed with a specific restriction endonuclease, and it is based on the polymorphism of resulted restriction fragments and hybridization. The key difference between RAPL and RFLP is that RAPD is a type of PCR technique performed without the prior sequence knowledge whereas RFLP is not involved in PCR and requires prior sequence knowledge to carry out the technique.


Two Measures of Similarity

Organisms that share similar physical features and genetic sequences tend to be more closely related than those that do not. Features that overlap both morphologically and genetically are referred to as homologous structures the similarities stem from common evolutionary paths. For example, as shown in Figure 12.2.1, the bones in the wings of bats and birds, the arms of humans, and the foreleg of a horse are homologous structures. Notice the structure is not simply a single bone, but rather a grouping of several bones arranged in a similar way in each organism even though the elements of the structure may have changed shape and size.

Figure 12.2.1: Bat and bird wings, the foreleg of a horse, the flipper of a whale, and the arm of a human are homologous structures, indicating that bats, birds, horses, whales, and humans share a common evolutionary past. (credit a photo: modification of work by Steve Hillebrand, USFWS credit b photo: modification of work by U.S. BLM credit c photo: modification of work by Virendra Kankariya credit d photo: modification of work by Russian Gov./Wikimedia Commons)

Misleading Appearances

Some organisms may be very closely related, even though a minor genetic change caused a major morphological difference to make them look quite different. For example, chimpanzees and humans, the skulls of which are shown in Figure 12.2.2 are very similar genetically, sharing 99 percent 1 of their genes. However, chimpanzees and humans show considerable anatomical differences, including the degree to which the jaw protrudes in the adult and the relative lengths of our arms and legs.

Figure 12.2.2: (a) The chimpanzee jaw protrudes to a much greater degree than (b) the human jaw. (credit a: modification of work by "Pastorius"/Wikimedia Commons)

However, unrelated organisms may be distantly related yet appear very much alike, usually because common adaptations to similar environmental conditions evolved in both. An example is the streamlined body shapes, the shapes of fins and appendages, and the shape of the tails in fishes and whales, which are mammals. These structures bear superficial similarity because they are adaptations to moving and maneuvering in the same environment&mdashwater. When a characteristic that is similar occurs by adaptive convergence (convergent evolution), and not because of a close evolutionary relationship, it is called an analogous structure. In another example, insects use wings to fly like bats and birds. We call them both wings because they perform the same function and have a superficially similar form, but the embryonic origin of the two wings is completely different. The difference in the development, or embryogenesis, of the wings in each case is a signal that insects and bats or birds do not share a common ancestor that had a wing. The wing structures, shown in Figure 12.2.3 evolved independently in the two lineages.

Similar traits can be either homologous or analogous. Homologous traits share an evolutionary path that led to the development of that trait, and analogous traits do not. Scientists must determine which type of similarity a feature exhibits to decipher the phylogeny of the organisms being studied.

Figure 12.2.3: The wing of a honey bee is similar in shape to a bird wing and a bat wing and serves the same function (flight). The bird and bat wings are homologous structures. However, the honey bee wing has a different structure (it is made of a chitinous exoskeleton, not a boney endoskeleton) and embryonic origin. The bee and bird or bat wing types illustrate an analogy&mdashsimilar structures that do not share an evolutionary history. (credit a photo: modification of work by U.S. BLM credit b: modification of work by Steve Hillebrand, USFWS credit c: modification of work by Jon Sullivan)

This website has several examples to show how appearances can be misleading in understanding the phylogenetic relationships of organisms.

With the advancement of DNA technology, the area of molecular systematics, which describes the use of information on the molecular level including DNA sequencing, has blossomed. New analysis of molecular characters not only confirms many earlier classifications, but also uncovers previously made errors. Molecular characters can include differences in the amino-acid sequence of a protein, differences in the individual nucleotide sequence of a gene, or differences in the arrangements of genes. Phylogenies based on molecular characters assume that the more similar the sequences are in two organisms, the more closely related they are. Different genes change evolutionarily at different rates and this affects the level at which they are useful at identifying relationships. Rapidly evolving sequences are useful for determining the relationships among closely related species. More slowly evolving sequences are useful for determining the relationships between distantly related species. To determine the relationships between very different species such as Eukarya and Archaea, the genes used must be very ancient, slowly evolving genes that are present in both groups, such as the genes for ribosomal RNA. Comparing phylogenetic trees using different sequences and finding them similar helps to build confidence in the inferred relationships.

Sometimes two segments of DNA in distantly related organisms randomly share a high percentage of bases in the same locations, causing these organisms to appear closely related when they are not. For example, the fruit fly shares 60 percent of its DNA with humans. 2 In this situation, computer-based statistical algorithms have been developed to help identify the actual relationships, and ultimately, the coupled use of both morphologic and molecular information is more effective in determining phylogeny.

EVOLUTION IN ACTION: Why Does Phylogeny Matter?

In addition to enhancing our understanding of the evolutionary history of species, our own included, phylogenetic analysis has numerous practical applications. Two of those applications include understanding the evolution and transmission of disease and making decisions about conservation efforts. A 2010 study 3 of MRSA (methicillin-resistant Staphylococcus aureus), an antibiotic resistant pathogenic bacterium, traced the origin and spread of the strain throughout the past 40 years. The study uncovered the timing and patterns in which the resistant strain moved from its point of origin in Europe to centers of infection and evolution in South America, Asia, North America, and Australasia. The study suggested that introductions of the bacteria to new populations occurred very few times, perhaps only once, and then spread from that limited number of individuals. This is in contrast to the possibility that many individuals had carried the bacteria from one place to another. This result suggests that public health officials should concentrate on quickly identifying the contacts of individuals infected with a new strain of bacteria to control its spread.

A second area of usefulness for phylogenetic analysis is in conservation. Biologists have argued that it is important to protect species throughout a phylogenetic tree rather than just those from one branch of the tree. Doing this will preserve more of the variation produced by evolution. For example, conservation efforts should focus on a single species without sister species rather than another species that has a cluster of close sister species that recently evolved. If the single evolutionarily distinct species goes extinct a disproportionate amount of variation from the tree will be lost compared to one species in the cluster of closely related species. A study published in 2007 4 made recommendations for conservation of mammal species worldwide based on how evolutionarily distinct and at risk of extinction they are. The study found that their recommendations differed from priorities based on simply the level of extinction threat to the species. The study recommended protecting some threatened and valued large mammals such as the orangutans, the giant and lesser pandas, and the African and Asian elephants. But they also found that some much lesser known species should be protected based on how evolutionary distinct they are. These include a number of rodents, bats, shrews and hedgehogs. In addition there are some critically endangered species that did not rate as very important in evolutionary distinctiveness including species of deer mice and gerbils. While many criteria affect conservation decisions, preserving phylogenetic diversity provides an objective way to protect the full range of diversity generated by evolution.

How do scientists construct phylogenetic trees? Presently, the most accepted method for constructing phylogenetic trees is a method called cladistics. This method sorts organisms into clades, groups of organisms that are most closely related to each other and the ancestor from which they descended. For example, in Figure 12.2.4, all of the organisms in the shaded region evolved from a single ancestor that had amniotic eggs. Consequently, all of these organisms also have amniotic eggs and make a single clade, also called a monophyletic group. Clades must include the ancestral species and all of the descendants from a branch point.

Lizards, rabbits, and humans all descend from a common ancestor in which the amniotic egg evolved. Thus, lizards, rabbits, and humans all belong to the clade Amniota. Vertebrata is a larger clade that also includes fish and lamprey.

Which animals in this figure belong to a clade that includes animals with hair? Which evolved first: hair or the amniotic egg?

Clades can vary in size depending on which branch point is being referenced. The important factor is that all of the organisms in the clade or monophyletic group stem from a single point on the tree. This can be remembered because monophyletic breaks down into &ldquomono,&rdquo meaning one, and &ldquophyletic,&rdquo meaning evolutionary relationship.

Shared Characteristics

Cladistics rests on three assumptions. The first is that living things are related by descent from a common ancestor, which is a general assumption of evolution. The second is that speciation occurs by splits of one species into two, never more than two at a time, and essentially at one point in time. This is somewhat controversial, but is acceptable to most biologists as a simplification. The third assumption is that traits change enough over time to be considered to be in a different state .It is also assumed that one can identify the actual direction of change for a state. In other words, we assume that an amniotic egg is a later character state than non-amniotic eggs. This is called the polarity of the character change. We know this by reference to a group outside the clade: for example, insects have non-amniotic eggs therefore, this is the older or ancestral character state. Cladistics compares ingroups and outgroups. An ingroup (lizard, rabbit and human in our example) is the group of taxa being analyzed. An outgroup (lancelet, lamprey and fish in our example) is a species or group of species that diverged before the lineage containing the group(s) of interest. By comparing ingroup members to each other and to the outgroup members, we can determine which characteristics are evolutionary modifications determining the branch points of the ingroup&rsquos phylogeny.

If a characteristic is found in all of the members of a group, it is a shared ancestral characterbecause there has been no change in the trait during the descent of each of the members of the clade. Although these traits appear interesting because they unify the clade, in cladistics they are considered not helpful when we are trying to determine the relationships of the members of the clade because every member is the same. In contrast, consider the amniotic egg characteristic of Figure 12.2.4. Only some of the organisms have this trait, and to those that do, it is called a shared derived character because this trait changed at some point during descent. This character does tell us about the relationships among the members of the clade it tells us that lizards, rabbits, and humans group more closely together than any of these organisms do with fish, lampreys, and lancelets.

A sometimes confusing aspect of &ldquoancestral&rdquo and &ldquoderived&rdquo characters is that these terms are relative. The same trait could be either ancestral or derived depending on the diagram being used and the organisms being compared. Scientists find these terms useful when distinguishing between clades during the building of phylogenetic trees, but it is important to remember that their meaning depends on context.

Choosing the Right Relationships

Constructing a phylogenetic tree, or cladogram, from the character data is a monumental task that is usually left up to a computer. The computer draws a tree such that all of the clades share the same list of derived characters. But there are other decisions to be made, for example, what if a species presence in a clade is supported by all of the shared derived characters for that clade except one? One conclusion is that the trait evolved in the ancestor, but then changed back in that one species. Also a character state that appears in two clades must be assumed to have evolved independently in those clades. These inconsistencies are common in trees drawn from character data and complicate the decision-making process about which tree most closely represents the real relationships among the taxa.

To aid in the tremendous task of choosing the best tree, scientists often use a concept called maximum parsimony, which means that events occurred in the simplest, most obvious way. This means that the &ldquobest&rdquo tree is the one with the fewest number of character reversals, the fewest number of independent character changes, and the fewest number of character changes throughout the tree. Computer programs search through all of the possible trees to find the small number of trees with the simplest evolutionary pathways. Starting with all of the homologous traits in a group of organisms, scientists can determine the order of evolutionary events of which those traits occurred that is the most obvious and simple.

Practice Parsimony: Go to this website to learn how maximum parsimony is used to create phylogenetic trees (be sure to continue to the second page).


Molecular Analysis of Proteins

In many cases it may not be desirable or possible to study DNA or RNA directly. Proteins can provide species-specific information for identification as well as important information about how and whether a cell or tissue is responding to the presence of a pathogenic microorganism. Various proteins require different methods for isolation and characterization.

Polyacrylamide Gel Electrophoresis

A variation of gel electrophoresis, called polyacrylamide gel electrophoresis (PAGE), is commonly used for separating proteins. In PAGE, the gel matrix is finer and composed of polyacrylamide instead of agarose. Additionally, PAGE is typically performed using a vertical gel apparatus (Figure 6). Because of the varying charges associated with amino acid side chains, PAGE can be used to separate intact proteins based on their net charges. Alternatively, proteins can be denatured and coated with a negatively charged detergent called sodium dodecyl sulfate (SDS), masking the native charges and allowing separation based on size only. PAGE can be further modified to separate proteins based on two characteristics, such as their charges at various pHs as well as their size, through the use of two-dimensional PAGE. In any of these cases, following electrophoresis, proteins are visualized through staining, commonly with either Coomassie blue or a silver stain.

Figure 6. Click for a larger image. (a) SDS is a detergent that denatures proteins and masks their native charges, making them uniformly negatively charged. (b) The process of SDS-PAGE is illustrated in these steps. (c) A photograph of an SDS-PAGE gel shows Coomassie stained bands where proteins of different size have migrated along the gel in response to the applied voltage. A size standard lane is visible on the right side of the gel. (credit b: modification of work by “GeneEd”/YouTube)

Think about It

Clinical Focus: Karni, Part 3

This example continues Karni’s story that started in Microbes and the Tools of Genetic Engineering and above.

Figure 7. A bulls-eye rash is one of the common symptoms of Lyme diseases, but up to 30% of infected individuals never develop a rash. (credit: Centers for Disease Control and Prevention)

When Karni described her symptoms, her physician at first suspected bacterial meningitis, which is consistent with her headaches and stiff neck. However, she soon ruled this out as a possibility because meningitis typically progresses more quickly than what Karni was experiencing. Many of her symptoms still paralleled those of amyotrophic lateral sclerosis (ALS) and systemic lupus erythematosus (SLE), and the physician also considered Lyme disease a possibility given how much time Karni spends in the woods. Karni did not recall any recent tick bites (the typical means by which Lyme disease is transmitted) and she did not have the typical bull’s-eye rash associated with Lyme disease (Figure 7). However, 20–30% of patients with Lyme disease never develop this rash, so the physician did not want to rule it out.

Karni’s doctor ordered an MRI of her brain, a complete blood count to test for anemia, blood tests assessing liver and kidney function, and additional tests to confirm or rule out SLE or Lyme disease. Her test results were inconsistent with both SLE and ALS, and the result of the test looking for Lyme disease antibodies was “equivocal,” meaning inconclusive. Having ruled out ALS and SLE, Karni’s doctor decided to run additional tests for Lyme disease.

  • Why would Karni’s doctor still suspect Lyme disease even if the test results did not detect Lyme antibodies in the blood?
  • What type of molecular test might be used for the detection of blood antibodies to Lyme disease?

We’ll return to Karni’s example in later pages.


DNA Markers: Definition, Properties and Applications

Those characters which can be easily identified are called marker characters. Any genetic element (locus, allele, DNA sequence or chromosome feature) which can be readily detected by phenotype, cytological or molecular techniques, and used to follow a chromosome or chromosomal segment during genetic analysis is referred to as marker.

Markers related to variations in DNA fragments generated by restriction endonuclease enzymes are called DNA markers or genetic markers.

Some other definitions of DNA markers are given below:

i. Any unique DNA sequence which can be used in DNA hybridization, PCR or restriction mapping experiments to identify that sequence is called DNA marker.

ii. A gene or DNA sequence having a known location on a chromosome and associated with a particular gene or trait refers to DNA marker.

Markers are of four types, viz:

These are briefly discussed as follows:

i. Morphological:

In plant breeding, markers that are related to variation in shape, size, colour and surface of various plant parts are called morphological markers. Such markers refer to available gene loci that have obvious impact on morphology of plant. Genes that affect form, coloration, male sterility or resistance among others have been analyzed in many plant species.

In rice, examples of this type of marker may include the presence or absence of awn, leaf sheath coloration, height, grain color, aroma etc. In well-characterized crops like maize, tomato, pea, barley or wheat, tens or even hundreds of such genes have been assigned to different chromosomes.

There are several demerits of morphological markers as given below:

a. They generally express late into the development of an organism. Hence their detection is dependent on the development stage of the organism.

b. They usually exhibit dominance.

c. Sometimes they exhibit deleterious effects.

d. They exhibit pleiotropy.

f. They exhibit less polymorphism.

g. They are highly influenced by the environmental factors.

Markers that are related to variation in proteins and amino acid banding pattern are known as biochemical markers. A gene encodes a protein that can be extracted and observed for example, isozymes and storage proteins.

iii. Cytological:

Markers that are related to variation in chromosome number, shape, size and banding pattern are referred to as cytological markers. In other words, it refers to the chromosomal banding produced by different stains for example, G banding.

A gene or other fragment of DNA whose location in the genome is known is called DNA marker. It is a unique (DNA sequence), occurring in proximity to the gene or locus of interest. It refers to any unique DNA sequence which can be used in DNA hybridization, PCR or restriction mapping experiments to identify that sequence.

It can be identified by a range of molecular techniques such as RFLPs, RAPDs, AFLP, SNPs, SCARs, microsatellites etc.

DNA markers are also known as molecular markers or genetic markers. To overcome problems associated with morphological markers, the DNA-based markers have been developed. Advantages of DNA markers are presented below.

a. They are highly polymorphic.

b. They have simple inheritance (often co-dominant).

c. They abundantly occur throughout the genome.

d. They are easy and fast to detect.

e. They exhibit minimum pleiotropic effect.

Their detection is not dependent on the developmental stage of the organism.

Properties of DNA Marker:

An ideal DNA marker should have some properties or characteristics.

Important properties of an ideal DNA marker are presented below:

i. Polymorphism:

Markers should exhibit high level of polymorphism. In other words, there should be variability in the markers. It should demonstrate measurable differences in expression between trait types and/or gene of interest.

Marker should be co-dominant. It means, there should be absence of intra-locus interaction. It helps in identification of heterozygotes from homozygotes.

iii. Multi-Allelic:

The marker should be multi-allelic. It useful in getting more variability/ polymorphism for a character.

iv. No Epistasis:

There should be absence of epistasis. It makes Identification of all phenotypes (homo- and heterozygotes) easy.

The marker should be neutral. The substitution of alleles at the marker locus should not alter the phenotype of an individual. This property is found in almost all the DNA markers.

vi. No Effect of Environment:

Markers should be insensitive to environment. This property is also found in almost all the DNA markers.

Applications of DNA Marker in Crop Improvement:

DNA markers have several useful applications in crop improvement.

The important applications are listed as follows:

i. DNA markers are useful in the assessment of genetic diversity in germplasm, cultivars and advanced breeding material.

ii. DNA markers can be used for constructing genetic linkage maps.

iii. DNA markers are useful in identification of new useful alleles in the germplasm and wild species of crop plants.

iv. DNA markers are used in the marker assisted or marker aided selection. MAS has several advantages over straight selection.


Serology: Overview

Other Body Fluids

DNA profiling has been performed successfully on a wide range of body fluids and tissues for which there are no common tests. Examples include skin (including dandruff), perspiration, nasal mucus, pus, breast milk, and ear wax. For the most part, the biological origin in these cases is inferred from the appearance of the material or its location on the item tested, for example, perspiration from hat bands, nasal mucus on tissues, and so on. There is little call for specific tests to determine the cellular identity of these materials each, however, has a characteristic biochemistry that could be exploited to develop an identification test should it be necessitated.


Far from special: Humanity's tiny DNA differences are 'average' in animal kingdom

Today's study, "Why should mitochondria define species?" published as an open-access article in the journal Human Evolution,builds on earlier work by Drs. Stoeckle and Thayer, including an examination of the mitochondrial genetic diversity of humans vs. our closest living and extinct relatives. The amount of color variation within each red box of the Klee diagram illustrates the far greater mitochondrial diversity among chimpanzees and bonobos than among living humans. Credit: The Rockefeller University

Researchers report important new insights into evolution following a study of mitochondrial DNA from about 5 million specimens covering about 100,000 animal species.

Mining "big data" insights from the world's fast-growing genetic databases and reviewing a large literature in evolutionary theory, researchers at The Rockefeller University in New York City and the Biozentrum at the University of Basel in Switzerland, published several conclusions today in the journal Human Evolution. Among them:

  • In genetic diversity terms, Earth's 7.6 billion humans are anything but special in the animal kingdom. The tiny average genetic difference in mitochondrial sequences between any two individual people on the planet is about the same as the average genetic difference between a pair of the world's house sparrows, pigeons or robins. The typical difference within a species, including humans, is 0.1% or 1 in 1,000 of the "letters" that make up a DNA sequence.
  • Genetic variation—the average difference in mitochondria DNA between two individuals of the same species—does not increase with population size. Because evolution is relentless, however, the lack of genetic variation offers insights into the timing of a species' emergence and its maintenance.
  • The mass of evidence supports the hypothesis that most species, be it a bird or a moth or a fish, like modern humans, arose recently and have not had time to develop a lot of genetic diversity. The 0.1% average genetic diversity within humanity today corresponds to the divergence of modern humans as a distinct species about 100,000—200,000 years ago—not very long in evolutionary terms. The same is likely true of over 90% of species on Earth today.
  • Genetically the world "is not a blurry place." Each species has its own specific mitochondrial sequence and other members of the same species are identical or tightly similar. The research shows that species are "islands in sequence space" with few intermediate "stepping stones" surviving the evolutionary process.

Among 1st "big data" insights from a growing collection of mitochondrial DNA

"DNA barcoding" is a quick, simple technique to identify species reliably through a short DNA sequence from a particular region of an organism. For animals, the preferred barcode regions are in mitochondria—cellular organelles that power all animal life.

The new study, "Why should mitochondria define species?" relies largely on the accumulation of more than 5 million mitochondrial barcodes from more than 100,000 animal species, assembled by scientists worldwide over the past 15 years in the open access GenBank database maintained by the US National Center for Biotechnology Information.

The researchers have made novel use of the collection to examine the range of genetic differences within animal species ranging from bumblebees to birds and reveal surprisingly minute genetic variation within most animal species, and very clear genetic distinction between a given species and all others.

"If a Martian landed on Earth and met a flock of pigeons and a crowd of humans, one would not seem more diverse than the other according to the basic measure of mitochondrial DNA," says Jesse Ausubel, Director of the Program for the Human Environment at The Rockefeller University, where the research was led by Senior Research Associate Mark Stoeckle and Research Associate David Thaler of the University of Basel, Switzerland.

"At a time when humans place so much emphasis on individual and group differences, maybe we should spend more time on the ways in which we resemble one another and the rest of the animal kingdom."

Says Dr. Stoeckle: "Culture, life experience and other things can make people very different but in terms of basic biology, we're like the birds."

The study results represent a surprise given predictions found in textbooks, and based on mathematical models of evolution, that the bigger the population of a species, the greater the genetic variation one expects to find. In fact, the mitochondrial diversity within 7.6 billion humans or 500 million house sparrows or 100,000 sandpipers from around the world is about the same.The paper notes, however, that evolution is relentless, that species are always changing, and, therefore, the degree of variation within a given species offers a clue into how long ago it emerged distinctly -- in other words, the older the species the greater the average genetic variation between its members. Credit: The Rockefeller University

"By determining the genetic variety within species of the animal kingdom, made possible only recently by the burgeoning number of DNA sequences, we've documented the absence of human exceptionalism."

Says. Dr. Thaler: "Our approach combines DNA barcodes, which are broad but not deep, from the entire animal kingdom with more detailed sequence information available for the entire mitochondrial genome of modern humans and a few other species. We analyzed DNA barcode sequences from thousands of modern humans in the same way as those from other animal species."

"One might have thought that, due to their high population numbers and wide geographic distribution, humans might have led to greater genetic diversity than other animal species," he adds. "At least for mitochondrial DNA, humans turn out to be low to average in genetic diversity."

"Experts have interpreted low genetic variation among living humans as a result of our recent expansion from a small population in which a sequence from one mother became the ancestor for all modern human mitochondrial sequences," says Dr. Thaler.

"Our paper strengthens the argument that the low variation in the mitochondrial DNA of modern humans also explains the similar low variation found in over 90% of living animal species—we all likely originated by similar processes and most animal species are likely young."

Genetic variation does not increase with population

The study results represent a surprise given predictions found in textbooks, and based on mathematical models of evolution, that the bigger the population of a species, the greater the genetic variation one expects to find.

"Is genetic diversity related to the size of the population?" asks Dr. Stoeckle. "The answer is no. The mitochondrial diversity within 7.6 billion humans or 500 million house sparrows or 100,000 sandpipers from around the world is about the same."

The paper notes, however, that evolution is relentless, that species are always changing, and, therefore, the degree of variation within a given species offers a clue into how long ago it emerged distinctly—in other words, the older the species the greater the average genetic variation between its members.

Genetically, 'the world is not a blurry place.' It is hard to find 'intermediates' -- the evolutionary stepping stones between species. The intermediates disappear. The research is a new way to show that species are 'islands in sequence space.' Each species has its own narrow, very specific consensus sequence, just as our phone system has short, unique numeric codes to tell cities and countries apart. Credit: The Rockefeller University

Evolutionary bottlenecks: the fresh new beginning of a species

While asteroids and ice ages have played major roles in evolutionary history, scientists speculate that another great driver may have been the microbial world, notably viruses, which periodically cull populations, leaving behind only those able to survive the deadly challenge.

"Life is fragile, susceptible to reductions in population from ice ages and other forms of environmental change, infections, predation, competition from other species and for limited resources, and interactions among these forces," says Dr. Thaler. Adds Dr. Thaler, "The similar sequence variation in many species suggests that all of animal life experiences pulses of growth and stasis or near extinction on similar time scales."

"Scholars have previously argued that 99% of all animal species that ever lived are now extinct. Our work suggests that most species of animals alive today are like humans, descendants of ancestors who emerged from small populations possibly with near-extinction events within the last few hundred thousand years."

'Islands in sequence space'

Another intriguing insight from the study, says Mr. Ausubel, is that "genetically, the world is not a blurry place. It is hard to find 'intermediates' - the evolutionary stepping stones between species. The intermediates disappear."

Dr. Thaler notes: "Darwin struggled to understand the absence of intermediates and his questions remain fruitful."

"The research is a new way to show that species are 'islands in sequence space.' Each species has its own narrow, very specific consensus sequence, just as our phone system has short, unique numeric codes to tell cities and countries apart."

Adds Dr. Thaler: "If individuals are stars, then species are galaxies. They are compact clusters in the vastness of empty sequence space."

The researchers say that with the bones or teeth of an ancient hominid, like those found in southern France or northern Spain, scientists might shed further light on the rate of evolution of the human species.

"It would be very exciting if over the next few years physical anthropologists and others were able to compare mitochondrial DNA from hominid species over the last 500,000 years," says Dr. Stoeckle.


Which Came First?

There is some evidence DNA may have occurred first, but most scientists believe RNA evolved before DNA.   RNA has a simpler structure and is needed in order for DNA to function. Also, RNA is found in prokaryotes, which are believed to precede eukaryotes. RNA on its own can act as a catalyst for certain chemical reactions.

The real question is why DNA evolved if RNA existed. The most likely answer for this is that having a double-stranded molecule helps protect the genetic code from damage. If one strand is broken, the other strand can serve as a template for repair. Proteins surrounding DNA also confer additional protection against enzymatic attack.


Genetically Modified Organisms

A genetically modified organism (GMO) is any organism whose genetic material has been altered using genetic engineering techniques. GMOs are a source of medicines and genetically modified foods and are also widely used in scientific research, along with the production of other goods.
Genetic modification involves the mutation, insertion, or deletion of genes. Inserted genes usually come from a different species in a form of horizontal gene-transfer.

Figure (PageIndex<1>): Glo Fish: The GloFish is a patented and trademarked brand of genetically modified (GM) fluorescent fish. A gene that encodes the green fluorescent protein, originally extracted from a jellyfish, that naturally produced bright green fluorescence was inserted into a zebrafish embryo.

Bacteria, plants, and animals have been genetically modified since the early 1970s for academic, medical, agricultural, and industrial purposes. In the US, GMOs such as Roundup-Ready soybeans and borer-resistant corn are part of many common processed foods. As in many of these biotechnology areas there is considerable controversy in the use of GMOs.


Watch the video: What is the difference between genetic testing, such as FISH testing, and DNA testing? (February 2023).